Gene Structure I: DNA and Chromatin Structures

Lou-sing Kan, Institute of Chemistry

September 9, 2003

Brief history to 1990

1869 Nucleic acid was discovered by F. Miescher, results published in 1871.

1894 Discovered that nucleic acid contains adenine, cytosine, guanine, uracil, posphoricacid and pentose by O. Hammarsten. The pentose was recognized as a ribose by P. A. Levene and W. A. Jacobs in 1909. Thus, the RNA was discovered.

1930 P. A. Levene found the pentose from thymus gland was deoxyribose. Thus, the DNA was discovered.

1944 O. T. Avery, C. M. MacLeod, M. McCarty postulated that nucleic acid was genetic materials. However, it was first described by F. Griffth in 1928.

1950 E. Chargaff published the compositions of A=T and G=C. This was called as Chargaff Rule.

1953 J. A. Watson and F. H. C. Crick postulated a double-stranded helical structure for DNA based on M. H. F. Wilkens and R. E. Franklinˇ¦s X-ray study results.

1957 A. Rich and co-workers published the triple-stranded nucleic acid structure.

1965 R. W. Holley published the nucleotide sequence of alanine t-RNA.

1970ˇ¦s The crystal structure of phenylanaline t-RNA was determined by A. Rich and A. Klug simultaneously.

1980ˇ¦s Z-DNA structure was discovered by A. Rich and A. H.-J. Wang.

1987 P. A. Sharp discovered intron

1987 T. R. Cech discovered RNA has enzymatic activity.

The base

The sugar

Nucleosides and nucleotides

ˇ@

Oligonucleotide (The phosphodiester linkage)

The base pairs (The hydrogen bonding)

ˇ@

The double-stranded DNA

ˇ@

The structure and properties of Bases

The structure of sugar

ˇ@

ˇ@

ˇ@

ˇ@

ˇ@

ˇ@

ˇ@

ˇ@

ˇ@

The structure of oligonucleotide

Cruciform structures in DNA

Inverted repeat

5ˇ¦ GGAATCGATCTTAAGATCGATTCC 3ˇ¦

3ˇ¦ CCTTAGCTAGAATTCTAGCTAAGG 5ˇ¦

ˇ@

Triple-stranded nucleic acids

Four-stranded DNA

Parallel

ˇ@

Telomere structure

The structure of chromatin